View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14541_low_19 (Length: 341)
Name: NF14541_low_19
Description: NF14541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14541_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 40 - 338
Target Start/End: Complemental strand, 37120355 - 37120069
Alignment:
| Q |
40 |
tttttatagtacactattattattggtttaagtttaactatatcaagcttgattttgatattggtttgttaatttatacacatttcactctcttattcag |
139 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37120355 |
tttttacaatacactattattattggtttaagtttaactatatcaagtttgattttgatatt------------tatacacatttcactctcttattcag |
37120268 |
T |
 |
| Q |
140 |
gtgggtcatttgcttacttgagagtagaaatgggagattttgttgccttcatagctgccggaaacatcctccttgaatatgtcattggcaacgccgcggt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37120267 |
gtgggtcatttgcttacttgagagtagaaatgggagattttgttgccttcatagctgccggaaacatcctccttgaatatgtcattggcaacgcggcggt |
37120168 |
T |
 |
| Q |
240 |
agctcgatcatggacctcctattttgccaccctctgcaacaaaaaccctgatgattttcgtataatagttcacaatatgaatcctgatgatgtccatct |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
37120167 |
agctcgatcatggacctcctattttgccaccctctgcaacaaaaaccctgatgattttcgtataatagttcacaatatgaatcctgattatggccatct |
37120069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 135 - 326
Target Start/End: Complemental strand, 37112017 - 37111826
Alignment:
| Q |
135 |
ttcaggtgggtcatttgcttacttgagagtagaaatgggagattttgttgccttcatagctgccggaaacatcctccttgaatatgtcattggcaacgcc |
234 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||||| ||||||||||||||||||||| |||| ||| |||| ||||||||| |
|
|
| T |
37112017 |
ttcaggtgggtcatttgcttacttaagagtagaattgggagattttgttgcctttatagctgccggaaacatcctctttgagtatatcataggcaacgcc |
37111918 |
T |
 |
| Q |
235 |
gcggtagctcgatcatggacctcctattttgccaccctctgcaacaaaaaccctgatgattttcgtataatagttcacaatatgaatcctga |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37111917 |
gcggtagctcgatcatggacctcctattttgccaccctctgcaacaaaaaccctgatgattttcgtataatagttcacaatatgaaccctga |
37111826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 136 - 327
Target Start/End: Original strand, 37135982 - 37136173
Alignment:
| Q |
136 |
tcaggtgggtcatttgcttacttgagagtagaaatgggagattttgttgccttcatagctgccggaaacatcctccttgaatatgtcattggcaacgccg |
235 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| ||||||| ||||| |||||||||||||| |||||||| |||||||||||||| || || || | |
|
|
| T |
37135982 |
tcaggtgggtcatttgcatacttaagagtagaattgggagactttgtggccttcatagctgctggaaacatactccttgaatatgttataggagcagcag |
37136081 |
T |
 |
| Q |
236 |
cggtagctcgatcatggacctcctattttgccaccctctgcaacaaaaaccctgatgattttcgtataatagttcacaatatgaatcctgat |
327 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||| | ||||||||||| |||||| |
|
|
| T |
37136082 |
ccgtagctcgatcatggacctcctattttgccaccctctgcaacaaaaatcctaacgattttcgtataatattccacaatatgaaccctgat |
37136173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University