View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14542_high_6 (Length: 290)
Name: NF14542_high_6
Description: NF14542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14542_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 15 - 181
Target Start/End: Original strand, 37900212 - 37900377
Alignment:
| Q |
15 |
aacattccattaaaaacctgaaaagattaaaacacattatcatttcttagcttaaaacacaaaagtattttcaacctcatactattttcataattgcaac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37900212 |
aacattccattaaaaacctgaaaagattaaaacacattatcatttcttagcttaaaacacaaa-gtattttcaacctcatactattttcataattgcaac |
37900310 |
T |
 |
| Q |
115 |
tctccatcttctcacttttgtattttagacaatatcaattctttaaaaaacacattaagcattatac |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37900311 |
tctccatcttctcacttttgtattttagacaatatcatttctttaaaaaacacattaagcattatac |
37900377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 247 - 281
Target Start/End: Original strand, 37900455 - 37900489
Alignment:
| Q |
247 |
gtgaaactgtactgtttagtgtttcttgagctttc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37900455 |
gtgaaactgtactgtttagtgtttcttgagctttc |
37900489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University