View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14545_high_11 (Length: 342)
Name: NF14545_high_11
Description: NF14545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14545_high_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 14 - 326
Target Start/End: Original strand, 8421875 - 8422187
Alignment:
| Q |
14 |
caaaggaagtggtgcaagctaagttaacatccatgtatgggaaaagcagcttgaggactagtaatggttccaaaagttttttcaacttgaaaaataacag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
8421875 |
caaaggaagtggtgcaagctaagttaacatccatgtatgggaaaagcagcttgaggactagtaatggttccaacagttttttcaacttgaaaactaacag |
8421974 |
T |
|
| Q |
114 |
ctctgaggactgcacaattattggaaggcctcaatcacatcccatccatacaaagggtcctggtgtctcgtccgtttttgaagttgaaggagaagaaaga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8421975 |
ctctgaggactgcacaattattggaaggcctcaatcacttcccatccatacaaagggtcctggtgtctcgtccgtttttgaagttgaaggagaagaaaga |
8422074 |
T |
|
| Q |
214 |
gcttgtcgaaacactttttcaacaaaacgtgcacacacggaaaataatagccccagagttggttatttcaagtcaccttctagcaaggaggaagttaatc |
313 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8422075 |
gcttgtcgaaacactttttcgacaaaacgtgcacacacggaaaataatagccccagagttggttatttcaagtcaccttctagcaaggaggaagttaatc |
8422174 |
T |
|
| Q |
314 |
ccgatgttgcttg |
326 |
Q |
| |
|
||||||||||||| |
|
|
| T |
8422175 |
ccgatgttgcttg |
8422187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University