View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14545_high_22 (Length: 224)
Name: NF14545_high_22
Description: NF14545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14545_high_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 9080995 - 9081126
Alignment:
| Q |
1 |
attatttgtttacttttcatttgtaatatgtattagttttggtaaagataaaatacnnnnnnnggtaacaccaaaatcttatatcttcttatatattggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9080995 |
attatttgtttacttttcatttgtaatatgtattagttttggtaaagataaaatacaaaaaaaggtcacaccaaaatcttatatcttcttatatattggc |
9081094 |
T |
 |
| Q |
101 |
gaaaaaatgaattaattgacagaaaaaataat |
132 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| |
|
|
| T |
9081095 |
gaaaaaatgaattaattgacagcaaaattaat |
9081126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 160 - 217
Target Start/End: Original strand, 9081222 - 9081279
Alignment:
| Q |
160 |
tattaattactttttgtgcaaaaatctactaaaaattgagttcatctacttgcctatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9081222 |
tattaattactttttgtgcaaaaatctactaaaaattgagttcatctacttgcctatg |
9081279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University