View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14545_low_22 (Length: 245)
Name: NF14545_low_22
Description: NF14545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14545_low_22 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 245
Target Start/End: Original strand, 9080760 - 9080992
Alignment:
| Q |
14 |
caaaaacaagtataacatgttagggtggagaccttggaaaacaagaattcctaatgctttgtctgtaagtgcatgccaaccc-cttttctcaaaagatat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||| |
|
|
| T |
9080760 |
caaaaacaagtataacatgttagggtggagaccttggaaaacaagaattcctaatgctttgtctgtaagtgcatgccaatcttcctttctcaaaagatat |
9080859 |
T |
 |
| Q |
113 |
aatatattaataatacacccatgcatatatgtggactaacttgtatatatgtctctattcatatcttttattacacttggtgtgtctattttataatata |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9080860 |
aatatattaataatacacccatgcatatatgtggactaacttgtatatatgtctctattcatatcttttattacacttagtgtgtctattttataatata |
9080959 |
T |
 |
| Q |
213 |
ttgcttctatataaaatattaatcaaaaattaa |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9080960 |
ttgcttctatataaaatattaatcaaaaattaa |
9080992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University