View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14545_low_23 (Length: 245)
Name: NF14545_low_23
Description: NF14545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14545_low_23 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 50 - 245
Target Start/End: Original strand, 22513309 - 22513504
Alignment:
| Q |
50 |
tggcagcagctccacgacaacaaatatcaggtggcttaggcgggagtggaggttgtgtcaatagattttctatcttttgatcttcacttacttgtaaagt |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22513309 |
tggcagcagctccacgacaacaaatatcaggtggcttaggcgggagtggaggttgtgtcgatagattttctatcttttgatcttcagttacttgtaaagt |
22513408 |
T |
 |
| Q |
150 |
attggcagtatgcttctggcattctttatttttagatggtaaaactaaagacttgttcacatccatatcccaatcttccttgacaaaattacattg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22513409 |
attggcagtatgcttctggcattctttatttttagatggtaaaactaaagacttgttcacatccatatcccaatcttccttgacagaattacattg |
22513504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 113 - 234
Target Start/End: Complemental strand, 42313865 - 42313744
Alignment:
| Q |
113 |
gattttctatcttttgatcttcacttacttgtaaagtattggcagtatgcttctggcattctttatttttagatggtaaaactaaagacttgttcacatc |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42313865 |
gattttctatcttttgatcttcacttatatgtaaagtattggcagtatgcttctggcattctttatttttagatggtaaaactaaagacttgtccacatc |
42313766 |
T |
 |
| Q |
213 |
catatcccaatcttccttgaca |
234 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
42313765 |
catatcccagtcttccttgaca |
42313744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 114 - 175
Target Start/End: Complemental strand, 42309897 - 42309836
Alignment:
| Q |
114 |
attttctatcttttgatcttcacttacttgtaaagtattggcagtatgcttctggcattctt |
175 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||| |||||||||| |||||| |
|
|
| T |
42309897 |
attttctatcttttgatcttcattaacttgtaaagtattggcaacatgcttctggtattctt |
42309836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 8 - 106
Target Start/End: Original strand, 13883974 - 13884072
Alignment:
| Q |
8 |
gaatatgaaatgaatgataaaatgacgaggaacaaaaactcatggcagcagctccacgacaacaaatatcaggtggcttaggcgggagtggaggttgtg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||| ||| |||||||||||| |
|
|
| T |
13883974 |
gaatatgaaatgaatgataaaatgacgaggaacaaaaactcatggcagcaactccacgacaacataaatcaggtggcttaggagggggtggaggttgtg |
13884072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University