View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14545_low_26 (Length: 224)

Name: NF14545_low_26
Description: NF14545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14545_low_26
NF14545_low_26
[»] chr6 (2 HSPs)
chr6 (1-132)||(9080995-9081126)
chr6 (160-217)||(9081222-9081279)


Alignment Details
Target: chr6 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 9080995 - 9081126
Alignment:
1 attatttgtttacttttcatttgtaatatgtattagttttggtaaagataaaatacnnnnnnnggtaacaccaaaatcttatatcttcttatatattggc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||| |||||||||||||||||||||||||||||||||    
9080995 attatttgtttacttttcatttgtaatatgtattagttttggtaaagataaaatacaaaaaaaggtcacaccaaaatcttatatcttcttatatattggc 9081094  T
101 gaaaaaatgaattaattgacagaaaaaataat 132  Q
    |||||||||||||||||||||| |||| ||||    
9081095 gaaaaaatgaattaattgacagcaaaattaat 9081126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 160 - 217
Target Start/End: Original strand, 9081222 - 9081279
Alignment:
160 tattaattactttttgtgcaaaaatctactaaaaattgagttcatctacttgcctatg 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9081222 tattaattactttttgtgcaaaaatctactaaaaattgagttcatctacttgcctatg 9081279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University