View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14546_high_11 (Length: 351)
Name: NF14546_high_11
Description: NF14546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14546_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 19 - 336
Target Start/End: Complemental strand, 48636051 - 48635734
Alignment:
| Q |
19 |
aagagaatttgggggatggggagtgtttggttgatgacaattgccatactcttatccttcggaatcatcgctcactctttcgacggcggcagcgcacccc |
118 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48636051 |
aagagaacttgggggatggggagtgtttggttgatgacaattgccatactcttatccttcggaatcatcgctcactctttcgacggcggcagcgcacccc |
48635952 |
T |
 |
| Q |
119 |
ccaaacaacaaccaactctctgtgatgaactcattcttccagccggttacccttgctccgaatttgtggtatacatttactacttttcttcaatattatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48635951 |
ccaaacaacaaccaactctctgtgatgaactcattcttccagccggttacccttgctccgaatttgtggtatacatttactacttttcttcaatattatc |
48635852 |
T |
 |
| Q |
219 |
ctttttctaattcatatctttctgttttcttgttaattggcgcttttaatttttgtattactttcagattgaaacaaaggatggtttcttgttaggtctt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48635851 |
ctttttctaattcatatctttctgttttcttgttaattggcgcttttaatttttgtattactttcagattgaaacaaaggatggtttcttgttaggtctt |
48635752 |
T |
 |
| Q |
319 |
cagcgcgtgtcttcttct |
336 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
48635751 |
cagcgcgtgtcttcttct |
48635734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University