View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14546_high_20 (Length: 289)
Name: NF14546_high_20
Description: NF14546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14546_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 84 - 276
Target Start/End: Original strand, 4738284 - 4738476
Alignment:
| Q |
84 |
ttaacgatttgtcaacttagggtattagctttagtgatttgtgaacgtgataaaatctagaatgaccctgatccaggtatttatagtgggtgtgacctag |
183 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4738284 |
ttaacgatttgtcaagttagggtatgagctttagtgatttgtgaacttgataagatctagaatgaccctgatccaggtatttatagtgggtgtgacctag |
4738383 |
T |
 |
| Q |
184 |
aggaaggcgcaatgacttcccagttcatcttggacatgggctgccaacttcctccttttcagggattgtggacagtgacctcttatgagccct |
276 |
Q |
| |
|
|||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4738384 |
aggaaggcacaatgacttcccggttcatctcggacatgggctgccaacttcctccttttcagggattgtggacagtgacgtcttatgagccct |
4738476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University