View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14546_high_21 (Length: 288)
Name: NF14546_high_21
Description: NF14546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14546_high_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 16 - 199
Target Start/End: Complemental strand, 13147945 - 13147762
Alignment:
| Q |
16 |
atgaataaactagaatatctcaagatgaatcgagtgagatcggtatgtttttgagaagacaaaaagtaaacaaatttaataaatctcaacaagtcgaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13147945 |
atgaataaactagaatatctcaagatgaatcgagtgagatcggtatgtttttgagaagacaaaaggtaaataaatttaataaatctcaacaagtcgaaat |
13147846 |
T |
|
| Q |
116 |
tgagcataatatggaaatcgaattattaagattccttttgcaattgtaatccggaaaatgttgatgaagaaatagcttttcaag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13147845 |
tgagcataatatggaaatcgaattattaagattccttttgcaattgtaatccggaaaatgttgatgaagaaatagctttccaag |
13147762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University