View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14546_high_23 (Length: 277)
Name: NF14546_high_23
Description: NF14546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14546_high_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 58 - 178
Target Start/End: Original strand, 9088119 - 9088240
Alignment:
| Q |
58 |
caaggaacctcaaatattttgataacgtttggatgattaatgatcttcatagctgaaatttctctcttcagctgccaaattcaaattcaacacaagaaaa |
157 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9088119 |
caaggtacctcaaatattttgataacgtttggatgattaatgatcttcatagctgaaatttctctcttcagctgccaaattcaaattcaacacaagaaaa |
9088218 |
T |
|
| Q |
158 |
g-aaaatcaaagatcaatgtcg |
178 |
Q |
| |
|
| |||| ||||||||| ||||| |
|
|
| T |
9088219 |
gaaaaaccaaagatcagtgtcg |
9088240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 58 - 178
Target Start/End: Original strand, 9079342 - 9079463
Alignment:
| Q |
58 |
caaggaacctcaaatattttgataacgtttggatgattaatgatcttcatagctgaaatttctctcttcagctgccaaattcaaattcaacacaagaaaa |
157 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9079342 |
caaggtacctcaaatattttgataacgtttggatgattaataatcttcatagctgaaatttctctcttcagctgccaaattcaaattcaacacaagaaaa |
9079441 |
T |
|
| Q |
158 |
g-aaaatcaaagatcaatgtcg |
178 |
Q |
| |
|
| |||| ||||||||| ||||| |
|
|
| T |
9079442 |
gaaaaaccaaagatcagtgtcg |
9079463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University