View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14546_high_27 (Length: 237)
Name: NF14546_high_27
Description: NF14546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14546_high_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 13147506 - 13147280
Alignment:
| Q |
1 |
atactaaacttttttacatcaacaccgttgactccacaagattaacactagactttccatcttcggttaaaccnnnnnnnnnn----aaattataaatat |
96 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13147506 |
atactaaacttttttacatcaataccgttgactccacaagattaacactagactttccatcttcggttaaaccttttttttttttttaaattataaatat |
13147407 |
T |
 |
| Q |
97 |
tcacatcaacgagtactctgacgctatctttaacaacataagattggtctcaatgaatattttgtttttgacaggatttatcatccttataaattgatgt |
196 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13147406 |
tcacatcaacgagtactctggcgctatatttaacaacataagattggtctcaatcaatattatgtttttgacaggatttatcatccttataaatttatgt |
13147307 |
T |
 |
| Q |
197 |
ac-tttcttgaaaaggaattgcttcat |
222 |
Q |
| |
|
|| |||||||||||||||||||||||| |
|
|
| T |
13147306 |
acttttcttgaaaaggaattgcttcat |
13147280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University