View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14546_high_30 (Length: 204)
Name: NF14546_high_30
Description: NF14546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14546_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 82 - 189
Target Start/End: Complemental strand, 15302462 - 15302351
Alignment:
| Q |
82 |
gaaacaagcacagtcctaaat----atatatgacaaatatacaaaggattcactattgtgtttgatactatcgatactccatcgaaaaacttattagacg |
177 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15302462 |
gaaacaagcacagtcctaaatgaatatatatgacaaatatacaaaggattcactattgtgtttgatactatcgatactccatcgaaaaacttattagacg |
15302363 |
T |
 |
| Q |
178 |
cataagaagtat |
189 |
Q |
| |
|
|||||||||||| |
|
|
| T |
15302362 |
cataagaagtat |
15302351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University