View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14546_low_15 (Length: 319)
Name: NF14546_low_15
Description: NF14546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14546_low_15 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 5 - 319
Target Start/End: Original strand, 29999352 - 29999666
Alignment:
| Q |
5 |
cattaacacctcctcaaggtgaaacaaacaaagatcttacaaaaccctcttctcctactacctcaggaggtgaagaagaggttcaaactcaaggagaaaa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29999352 |
cattaacacctcctcaaggtgaaacaaacaaagatcttacaaaaccctcttctcctactacctcaggaggtgaagaagaggttcaaactcaaggagataa |
29999451 |
T |
|
| Q |
105 |
gtcagaaagtagagaagaaaaggaagattctttgatggatgatgaagaaggagatgaatttggtttatctgatgttgttttaagtgatgatttctttgag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29999452 |
gtcagaaagtagagaagaaaaggaagattctttgatggatgatgaagaaggagatgaatttggtttatctgatgttgttttaagtgatgatttctttgag |
29999551 |
T |
|
| Q |
205 |
agtttagatgaatttggtttcacagatccattttcttctgctattgcaattcctaattgggttgataatactgctgctgctgctacagctgctggtggta |
304 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
29999552 |
agtttagatgaatttggtttcccagatccattttcttctgctatttcaattcctaattgggttgctaatactgctgctgctactacagctgctggtggta |
29999651 |
T |
|
| Q |
305 |
gctgatttgttttgt |
319 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
29999652 |
gctgatttgttttgt |
29999666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University