View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14546_low_18 (Length: 303)
Name: NF14546_low_18
Description: NF14546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14546_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 19 - 87
Target Start/End: Original strand, 21075481 - 21075550
Alignment:
| Q |
19 |
aatagtggcatatgacagaaggccgagtccatt-cgagtgtcataagaattcaatacgacaacacaggtt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21075481 |
aatagtggcatatgacagaaggccgagtccatttcgagtgtcataagaattcaatacgacaacagaggtt |
21075550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University