View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14546_low_21 (Length: 289)

Name: NF14546_low_21
Description: NF14546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14546_low_21
NF14546_low_21
[»] chr3 (1 HSPs)
chr3 (84-276)||(4738284-4738476)


Alignment Details
Target: chr3 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 84 - 276
Target Start/End: Original strand, 4738284 - 4738476
Alignment:
84 ttaacgatttgtcaacttagggtattagctttagtgatttgtgaacgtgataaaatctagaatgaccctgatccaggtatttatagtgggtgtgacctag 183  Q
    ||||||||||||||| ||||||||| |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||    
4738284 ttaacgatttgtcaagttagggtatgagctttagtgatttgtgaacttgataagatctagaatgaccctgatccaggtatttatagtgggtgtgacctag 4738383  T
184 aggaaggcgcaatgacttcccagttcatcttggacatgggctgccaacttcctccttttcagggattgtggacagtgacctcttatgagccct 276  Q
    |||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
4738384 aggaaggcacaatgacttcccggttcatctcggacatgggctgccaacttcctccttttcagggattgtggacagtgacgtcttatgagccct 4738476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University