View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14546_low_29 (Length: 225)
Name: NF14546_low_29
Description: NF14546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14546_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 11 - 207
Target Start/End: Complemental strand, 14130564 - 14130374
Alignment:
| Q |
11 |
gaaaagaacatataaggccattttcatattttaaaaacatgtctaatatcagagtgcaaagtggtcctctcttaatcaaagtatggtagaggtagagaca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
14130564 |
gaaaagaacatataaggccattttcatattttaaaaacatgtctaatatcagagtggaaagtggtcctctcctaatcaaagtatggtagag------aca |
14130471 |
T |
 |
| Q |
111 |
gttatggtctgtgttcactctcaagtactactcatagtgattttgctattgccatcaaccaaatacttgttcaagattcaaccatattacactattt |
207 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14130470 |
gttatggtctgtgttaactctcaagtactactcatagtgattttgctattgccattaaccaaatacttgttcaagattcaaccatattacactattt |
14130374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University