View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14546_low_4 (Length: 625)
Name: NF14546_low_4
Description: NF14546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14546_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 4e-61; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 4e-61
Query Start/End: Original strand, 336 - 455
Target Start/End: Complemental strand, 37306014 - 37305895
Alignment:
| Q |
336 |
tcatgttattgatgtttttgtttcctttttgaagtggcacattaatctcattgaaacaccgctaaagctgacagaagaatctaacaaagaattcatcatc |
435 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37306014 |
tcatgttattgatgtttttgtttcctttttgaagtggcacattaatctcattgaaacaccgctaaagctgacagaagaatctaacaaagaattcatcatc |
37305915 |
T |
 |
| Q |
436 |
tgaaagccatttaaggatct |
455 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
37305914 |
tgaaagccatttaaggatct |
37305895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 117; E-Value: 3e-59
Query Start/End: Original strand, 486 - 613
Target Start/End: Complemental strand, 37305864 - 37305739
Alignment:
| Q |
486 |
gattttctagttgaagcttttttgattgtgaaatatgcaagctggtttaatgattccagctagtaacatgcattcaatgatcggaagaaacaacaataac |
585 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37305864 |
gattttctagttgaagcttttttgattg--aaatatgcaagctggtttaatgattccagctagtaacatgcattcaatgatcggaagaaacaacaataac |
37305767 |
T |
 |
| Q |
586 |
gttggtgtctttggtttatcttcatctc |
613 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37305766 |
gttggtgtctttggtttatcttcatctc |
37305739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 152 - 241
Target Start/End: Complemental strand, 37306196 - 37306107
Alignment:
| Q |
152 |
gattatgcttgttcttatgctgatttcaaatataacaaaagaatttaacatgcattttaattatgcttaaaaattcttagaagcataaag |
241 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37306196 |
gattatgcttgttcctatgctgatttcaaatataacaaaagaatttaacatgcattttaattatgcttaaaaattcttagaagcataaag |
37306107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 50 - 104
Target Start/End: Complemental strand, 37306294 - 37306240
Alignment:
| Q |
50 |
cttttaaaaatacttatgtctccgtccatatagttagggttgctagaatgtcata |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37306294 |
cttttaaaaatacttatgtctccgtccatatagttagggttgctagaatgtcata |
37306240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University