View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14548_low_4 (Length: 267)
Name: NF14548_low_4
Description: NF14548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14548_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 19 - 258
Target Start/End: Original strand, 5287602 - 5287841
Alignment:
| Q |
19 |
ggttctttgtagtcactttttgcataaagtgtgtttgtatgaatcccatctgttgtctaatctctctagtctttggtcaacaaattagctggcagttttt |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5287602 |
ggttctttgtagtctctttttgcataaagtgtgtttgtatgaatcccatttgttgtctaatctctctaatctttggtcaacaaattagctggcagttttt |
5287701 |
T |
 |
| Q |
119 |
tcattgagttgcttcttgctggagattcccatgtgtaacatgtaagaatactaaattcttagttaacacactccacaagttctctaccaagatgagaatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5287702 |
tcattgagttgcttcttgctggagattcccatgtgtaacatgtaagaatactaaattcttagttaacacactccacaagttctctaccaagatgagaatc |
5287801 |
T |
 |
| Q |
219 |
ttctagacaataaggataagtttcttttctttcttgatga |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5287802 |
ttctagacaataaggataagtttcttttctttctttatga |
5287841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University