View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14548_low_5 (Length: 266)
Name: NF14548_low_5
Description: NF14548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14548_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 17 - 250
Target Start/End: Complemental strand, 45128491 - 45128267
Alignment:
| Q |
17 |
caagtaagtcattctcaaggttttaaactgcttgcggtcgcattctctaatttcttagaatcaaagttaaatgtggtttatgtggcctcatttgaggtcg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45128491 |
caagtaagtcattctcaaggttttaaactgcttgcggtcgcattctctaatttcttagaatcaaagttaaatgtgg---------cctcatttgaggtcg |
45128401 |
T |
 |
| Q |
117 |
ccaagacatcaaaaccttgatgtcacagcccaaatagttgtccctggatctgtttttaaaaccttggtgcttctcactaagctaaattaacttgtaattt |
216 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45128400 |
ccaagacatcaaaaccttgatttcacagcccgaatagttgtccgtggatctgtttttaaaaccttggtgcttctcactaagctaaaataacttgtaattt |
45128301 |
T |
 |
| Q |
217 |
tattgggccaatgatttagcttcactttgtctgt |
250 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
45128300 |
tattgggccaatgatttagcttcaatttgtctgt |
45128267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University