View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14549_low_4 (Length: 314)
Name: NF14549_low_4
Description: NF14549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14549_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 2 - 299
Target Start/End: Complemental strand, 22702567 - 22702270
Alignment:
| Q |
2 |
agagagaaagtcagggtaacacctatgatagaaaatatggacggtcccgtcttggtttgtttgggcatgtgtggagacaactcgtatcccagtatagatg |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
22702567 |
agagagaaagtcagggtaacacctatgatagaatatatggacggtcccgtcttggtttgtttgggcatgtgtggagacaactcgtatcccagtatatatg |
22702468 |
T |
 |
| Q |
102 |
acagaccaaatagaggatagtctaatgattagaggtagagagatagactaatggataactataaaccaaaccgttgagaagtattttgatttaaatggtt |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22702467 |
acagaccaaatagaggatagtccaatgattagaggtagagagatagactaatggataactataaaccaaaccgttgagaagtattttgatttaaatggtt |
22702368 |
T |
 |
| Q |
202 |
tattattagacatgcttcatgataagacattagagcggtttcatttgattagcaggccttatttaatgagaaaagacttgggttgttgcagttcaaaa |
299 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22702367 |
tattattagacatgattcatgataagacattagagcggtttcatttgattagcaggccttatttaatgagataagacttgggttgttgcagttcaaaa |
22702270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University