View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1454_high_10 (Length: 204)

Name: NF1454_high_10
Description: NF1454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1454_high_10
NF1454_high_10
[»] chr8 (1 HSPs)
chr8 (98-180)||(39793435-39793517)


Alignment Details
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 98 - 180
Target Start/End: Original strand, 39793435 - 39793517
Alignment:
98 ccctgcaacaggtttgtttctacttcccnnnnnnnggggactgagcaaaacaaaagataccatcatacgaagtggtaggttgc 180  Q
    ||||||||||||||||||||||||| ||        ||||||||||| ||| |||||||||||||||||||||||||||||||    
39793435 ccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgc 39793517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University