View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1454_high_4 (Length: 255)
Name: NF1454_high_4
Description: NF1454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1454_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 26336057 - 26336202
Alignment:
| Q |
1 |
actctctcagatatcaccaattctattgcttatgtctctgttgctggaaatgactactatgattacatggccatagatggctctctttcggtaaattact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26336057 |
actctctcagatatcaccaattctattgcttatgtctctgttgctggaaatgactactatgattacatggccatagatggctctctttcggtaaattact |
26336156 |
T |
 |
| Q |
101 |
taattttaatcatcatactttatatatttctatgatgtaaagtatg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26336157 |
taattttaatcatcatactttatatatttctatgatgtaaagtatg |
26336202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 23 - 97
Target Start/End: Original strand, 26323062 - 26323136
Alignment:
| Q |
23 |
ctattgcttatgtctctgttgctggaaatgactactatgattacatggccatagatggctctctttcggtaaatt |
97 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| || ||||| |||||| | ||||||||||| ||||||||| |
|
|
| T |
26323062 |
ctattgcttatgtctcagttgctggaaatgactacaatcattacttggccacaaatggctctcttccggtaaatt |
26323136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 26328346 - 26328402
Alignment:
| Q |
1 |
actctctcagatatcaccaattctattgcttatgtctctgttgctggaaatgactac |
57 |
Q |
| |
|
|||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26328346 |
actccctcagatatcaccaaatctatagcttatgtctctgttgctggaaatgactac |
26328402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University