View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1454_high_5 (Length: 238)
Name: NF1454_high_5
Description: NF1454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1454_high_5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 25 - 238
Target Start/End: Complemental strand, 11895490 - 11895277
Alignment:
| Q |
25 |
catcatcacttatcttattgtattttttacgttgttgaattatgtcannnnnnngcgttatccaccatacaaaaccctccaaacatcaagctgaagcaca |
124 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11895490 |
catcatcacttatcttattatattttttacgttgttgaattatgtcatttttttgtgttatccaccatacaaaaccctccaaacatcaagctgaaacaca |
11895391 |
T |
 |
| Q |
125 |
atctggaatagttcaaattatataatccaaactgcttatgaaatgttcagattatataatccgaactgtgccagactacatacaatgatgttacaccaaa |
224 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11895390 |
gtctgggatagttcaaattatataatccaaactgcttatgaaatgttcagattgtataatccaaactgtgccagactacatacgatgatgttacaccaaa |
11895291 |
T |
 |
| Q |
225 |
ggtttgaatgatct |
238 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
11895290 |
ggtttgaatgatct |
11895277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University