View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1454_low_13 (Length: 222)

Name: NF1454_low_13
Description: NF1454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1454_low_13
NF1454_low_13
[»] chr8 (1 HSPs)
chr8 (15-89)||(36934991-36935065)


Alignment Details
Target: chr8 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 15 - 89
Target Start/End: Complemental strand, 36935065 - 36934991
Alignment:
15 cagagaaaatggagttggatttaacatcgaaaacagcagaaacattgtttgaaggagacggtggtagttttgttc 89  Q
    |||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
36935065 cagaaaaaatggagttggatttaacaccgaaaacagcagaaacattgtttgaaggagacggtggtagttttgttc 36934991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University