View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1454_low_6 (Length: 293)
Name: NF1454_low_6
Description: NF1454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1454_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 72 - 235
Target Start/End: Original strand, 40578525 - 40578687
Alignment:
| Q |
72 |
actgactgactcaaaggtttgaagttgctgagatttgagagagagatgctaggttggttctgcggctacnnnnnnnngccttaaaatttcggtgttttta |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
40578525 |
actgactgactcaaaggtttgaagttgctgagatttgagagagagatgctaggttggttctgcggctgcttttttt-gccttaaaatttcggtgttttta |
40578623 |
T |
 |
| Q |
172 |
atgtatgaagtgaagtgtatgttgtgttgtgtaggttctttctttttctctcttatcttataat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40578624 |
atgtatgaagtgaagtgtatgttgtgttgtgtaggttcttcctttttctctcttatcttataat |
40578687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University