View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14551_low_3 (Length: 263)
Name: NF14551_low_3
Description: NF14551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14551_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 179 - 247
Target Start/End: Original strand, 16978144 - 16978212
Alignment:
| Q |
179 |
tccaaatcaacaaagtttttatctttatcatcaaactcaccacttcctttactttcatcagtctttact |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16978144 |
tccaaatcaacaaagtttttatctttatcatcaaactcaccatttcctttactttcatcagtctttact |
16978212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 37 - 66
Target Start/End: Original strand, 16978002 - 16978031
Alignment:
| Q |
37 |
atcatcatagtgagagccagaagaactatt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16978002 |
atcatcatagtgagagccagaagaactatt |
16978031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University