View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14552_low_12 (Length: 226)
Name: NF14552_low_12
Description: NF14552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14552_low_12 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 108 - 226
Target Start/End: Original strand, 12167156 - 12167274
Alignment:
| Q |
108 |
tgattcgtctcagatatcaaaagtcttaggaccgactctggttgcactcaacatttgattcatggaacaagaacatactatctatttaatagtaggattc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12167156 |
tgattcgtctcagatatcaaaagtcttaggaccgactctggttgcactcaacatttgattcatggaacaagaacatactatcaatttaatagtaggattc |
12167255 |
T |
 |
| Q |
208 |
tatttaatgccataatata |
226 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12167256 |
tatttaatgccataatata |
12167274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 12167094 - 12167158
Alignment:
| Q |
1 |
tttatttttaactcacttttattaattcaatgaaaaatattttatttagacaaccttgtttatga |
65 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12167094 |
tttatttttaactcaattttattaattcaatgaaaaatattttatttagacaaccttgtttatga |
12167158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 71
Target Start/End: Original strand, 31277936 - 31278002
Alignment:
| Q |
5 |
tttttaactcacttttattaattcaatgaaaaatattttatttagacaaccttgtttatgaatgaat |
71 |
Q |
| |
|
||||||||||||||| |||||||| || ||||||||| |||||| ||||||| |||| ||||||| |
|
|
| T |
31277936 |
tttttaactcactttgattaattctattgaaaatatttattttagagaaccttgattataaatgaat |
31278002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 327981 - 328042
Alignment:
| Q |
7 |
tttaactcacttttattaattcaatgaaaaatattttatttagacaaccttgtttatgaatg |
68 |
Q |
| |
|
||||||||||||| |||||||| || ||||||||||| |||| | ||| || |||||||||| |
|
|
| T |
327981 |
tttaactcactttgattaattctattaaaaatattttttttataaaactttatttatgaatg |
328042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University