View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14553_low_3 (Length: 244)
Name: NF14553_low_3
Description: NF14553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14553_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 5974188 - 5974404
Alignment:
| Q |
18 |
gtcctcacggtttaaactgttttaatgcctcatttaggatccgttatggctgtctttttctttaatttcagtacgttataacttatcatttcttttacac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5974188 |
gtcctcacggtttaaactgttttaatgcctcatttaggatccgttatggctgtctttttctttaatttcagtacgttataacttatcatttcttttacac |
5974287 |
T |
 |
| Q |
118 |
aatattaacatcacttttttagcaaaagatcagtttagttaatttgacattaaatacgtgtggttagctgttaactaaacctttgtttatgattatttga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5974288 |
aatattaacatcacttttttagcaaaagatcagtttagttaatttgacattaaatacgtgtggttagctgttaactaaacctttgtttatgattatttga |
5974387 |
T |
 |
| Q |
218 |
gtgaataccttcctttg |
234 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
5974388 |
gcgaataccttcctttg |
5974404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University