View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14554_high_14 (Length: 232)
Name: NF14554_high_14
Description: NF14554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14554_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 14 - 225
Target Start/End: Complemental strand, 34699050 - 34698839
Alignment:
| Q |
14 |
gcaacatggttgcttcgttggtttcaacaccaccgaacccaaaagccaccacgtggttccacttggcaaactcaaaggaatccggttcatgagtatattc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34699050 |
gcaacatggttgcttcgttggtttcaacaccaccgaacccaaaagccaccacgtggttccacttggcaaactcaaaggaatccggttcatgagtatattc |
34698951 |
T |
 |
| Q |
114 |
cggtttaaggtttggtggacaactcattggaccggaaccaacggacatgagttagaacatgagacacaaatgttaatccttgaccaaaacaaatcactcg |
213 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34698950 |
cgttttaaggtttggtggacaactcattggaccggaaccaacggacatgagttagaacatgagacacaaatgttaatccttgaccaaaacaaatcactcg |
34698851 |
T |
 |
| Q |
214 |
gacgcccctatg |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34698850 |
gacgcccctatg |
34698839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University