View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14554_low_12 (Length: 268)
Name: NF14554_low_12
Description: NF14554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14554_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 2489169 - 2489421
Alignment:
| Q |
1 |
ggtactgatataatctgtgtgtcctttgtctctgtatgtatcatcccgaataaagaaaaaagaggaaggagctgctgtgaaaccagaaggaaagactgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489169 |
ggtactgatataatctgtgtgtcctttgtctctgtatgtatcatcccgaataaagaaaaaagaggaaggagctgctgtgaaaccagaaggaaagactgaa |
2489268 |
T |
|
| Q |
101 |
agtcctgctcctgctgtaaagactgaagcagaaataccaacttcagtgcgcaaaactgatggtgaaaattcagttcctgcatccaaagctgtaagccttc |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489269 |
agtcctgcacctgctgtaaagactgaagcagaaataccaacttcagtgcgcaaaactgatggtgaaaattcagttcctgcatccaaagctgtaagccttc |
2489368 |
T |
|
| Q |
201 |
tctgttttctaattattagatatattacaatttaattttaatagtgttgaaat |
253 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489369 |
tctgttttctaattgttagatatattacaatttaattttaatagtgttgaaat |
2489421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University