View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14554_low_17 (Length: 244)
Name: NF14554_low_17
Description: NF14554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14554_low_17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 53042387 - 53042612
Alignment:
| Q |
19 |
tatgcaacaatgtatttaatcagtattaannnnnnnnnnnnnctttatcatcttcatgtagacaacggcatcaaaaagtggtgctctgcgccatgatatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53042387 |
tatgcaacaatgtatttaatcagtattaatttttttctttttctttatcatcttcacgtagacaacggcatcaaaaagtggtgctctgcgccatgatatt |
53042486 |
T |
 |
| Q |
119 |
cattattggcttggtaaagacaccagtcaggtaagttttattgttcgtatattctcatcccctttcgcctgtttttagttcactatttgttataattttc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53042487 |
cattattggcttggtaaagacaccagtcaggtaagttttattgttcgtatattgtcatcccctttcgcctgtttttagttcactatttgttataattttc |
53042586 |
T |
 |
| Q |
219 |
ccatttactcaatggtgatcataact |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
53042587 |
ccatttactcaatggtgatcataact |
53042612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 76 - 152
Target Start/End: Complemental strand, 15965444 - 15965368
Alignment:
| Q |
76 |
gtagacaacggcatcaaaaagtggtgctctgcgccatgatattcattattggcttggtaaagacaccagtcaggtaa |
152 |
Q |
| |
|
||||||||| || |||||||||||||||||||| ||||| || ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
15965444 |
gtagacaactgcctcaaaaagtggtgctctgcgtcatgacatccattactggattggtaaagacaccagtcaggtaa |
15965368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University