View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14554_low_19 (Length: 226)
Name: NF14554_low_19
Description: NF14554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14554_low_19 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 7 - 226
Target Start/End: Complemental strand, 50013505 - 50013283
Alignment:
| Q |
7 |
gtaatgttagaagtctcacatcaaataaattaaagtacttgatgttgtatttaaatcatgatgtttctcatctaattgactagtcttttgaattagactc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
50013505 |
gtaatgttagaagtctcacatcaaataa-ttaaagtatttgatgtagtatttaaatcatgatgtttctcatctaattgactagtcttttgagttagattc |
50013407 |
T |
 |
| Q |
107 |
gttcggcagacttaagtcgtaacagaca----cttgataataacactcattgctataagcttttttgaatgatcgaagagggtaaagtgtggtagcaaac |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50013406 |
gttcggcagacttaagtcgtaacagacagacacttgataataacactcattgctataagcttttttgaatgatcgaagagggtaaaatgtggtagcaaac |
50013307 |
T |
 |
| Q |
203 |
aatttgctataagcttcgagaatc |
226 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
50013306 |
aatttgctataagcttcgagaatc |
50013283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University