View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14554_low_21 (Length: 207)
Name: NF14554_low_21
Description: NF14554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14554_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 8e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 36 - 158
Target Start/End: Original strand, 3219712 - 3219832
Alignment:
| Q |
36 |
ggctcatgggtgcgacacgacgaaaccccattttgcattgaagtttagagtagcactactgatagtggtcagatagcgctgcagtaaagctcatgtaaaa |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3219712 |
ggctcatgggtgcgacacgacgaaaccccattttgcattgaagtttagagtagcactactgatagtggtcagatagcgctgcagtaaagctcatgt--aa |
3219809 |
T |
|
| Q |
136 |
aattctaaactttttgcaatatc |
158 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3219810 |
aattctaaactttttgcaatatc |
3219832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 58 - 95
Target Start/End: Complemental strand, 15985969 - 15985932
Alignment:
| Q |
58 |
aaaccccattttgcattgaagtttagagtagcactact |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15985969 |
aaaccccattttgcattgaagtttagagtagcgctact |
15985932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University