View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14554_low_8 (Length: 337)
Name: NF14554_low_8
Description: NF14554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14554_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 318
Target Start/End: Original strand, 9438036 - 9438353
Alignment:
| Q |
1 |
atgattacaattgatctgcaatagacctcaattgactttacgacnnnnnnngtgatatagatatcgagtagaggatgcaatttgataagaatttgttttg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9438036 |
atgattacaattgatttgcaatagacctcaattgactttacgacaaaacaagtgatatagatttcgagtagaggatgcaatttgataagaatttgttttg |
9438135 |
T |
 |
| Q |
101 |
gtttcaatgaacttagcagtgaaattcacaaaataagtgcataaaaatagaaaattgtgcgttgaaatttgcgttctaaaatatcaaatgttcatgcagt |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
9438136 |
gtttcaatgaacttagcagcgaaattcacaaaataagtgcataaaaatagaaaattgtgcgttgaaacctgcgttctaacatatcaaatgttcatgcagt |
9438235 |
T |
 |
| Q |
201 |
cttttatcatttgagttgtactaatgaaacttggtattatggtagttcaacaataataatacagcgtttatttatgtactttgcagctgtatattaatac |
300 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9438236 |
cttttatcatctgagttgtactattgaaacttggtattatggtagttcaacaataataatgcagcgtttatttatgtactttgcagctgtatattaatac |
9438335 |
T |
 |
| Q |
301 |
gtaggtgaatgaaatttc |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
9438336 |
gtaggtgaatgaaatttc |
9438353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University