View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14555_high_4 (Length: 261)
Name: NF14555_high_4
Description: NF14555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14555_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 16 - 245
Target Start/End: Complemental strand, 8757273 - 8757038
Alignment:
| Q |
16 |
ctgatgattattatgatttccttgcttcccaccatcattaccattaccattacca------agtccattaccattaggagtattggaattggccaaaatg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8757273 |
ctgatgattattatgatttccttgcttcccaccatcattaccattaccattaccattaccgagtccattaccattaggagtattggaattggccaaaatg |
8757174 |
T |
|
| Q |
110 |
ttctgattttgatttgcttcatttccttcattgggctgcttggaagcagcatgaattgccatagtacttgtgatcactctatgcagatttcttggtcttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8757173 |
ttctgattttgatttgcttcatttccttcattgggctgcttggaagcagcatgaattgccatagtacttgtgatcactctatgcagatttcttggtcttt |
8757074 |
T |
|
| Q |
210 |
cacctaatggatgatgcgatacacgaccatgtttat |
245 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8757073 |
cacctaatggatgatgtgatacacgaccatgtttat |
8757038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University