View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14555_high_4 (Length: 261)

Name: NF14555_high_4
Description: NF14555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14555_high_4
NF14555_high_4
[»] chr5 (1 HSPs)
chr5 (16-245)||(8757038-8757273)


Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 16 - 245
Target Start/End: Complemental strand, 8757273 - 8757038
Alignment:
16 ctgatgattattatgatttccttgcttcccaccatcattaccattaccattacca------agtccattaccattaggagtattggaattggccaaaatg 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||      |||||||||||||||||||||||||||||||||||||||    
8757273 ctgatgattattatgatttccttgcttcccaccatcattaccattaccattaccattaccgagtccattaccattaggagtattggaattggccaaaatg 8757174  T
110 ttctgattttgatttgcttcatttccttcattgggctgcttggaagcagcatgaattgccatagtacttgtgatcactctatgcagatttcttggtcttt 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8757173 ttctgattttgatttgcttcatttccttcattgggctgcttggaagcagcatgaattgccatagtacttgtgatcactctatgcagatttcttggtcttt 8757074  T
210 cacctaatggatgatgcgatacacgaccatgtttat 245  Q
    |||||||||||||||| |||||||||||||||||||    
8757073 cacctaatggatgatgtgatacacgaccatgtttat 8757038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University