View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14555_high_5 (Length: 234)
Name: NF14555_high_5
Description: NF14555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14555_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 8 - 208
Target Start/End: Complemental strand, 17602951 - 17602752
Alignment:
| Q |
8 |
attttctttggaatttgataacgtgtagactttgatgttaattgaactttaatccttgaagtgatgcttttgttggggataacttgttgggaattattaa |
107 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17602951 |
attttctttggattttgataacgtgtagactttgatgttgattgaactttaatccttgaagtgatgcttttgttggggataacttgttgggaattattaa |
17602852 |
T |
 |
| Q |
108 |
tggagagtatggttgatgttaaattttggtgaagaccttaaatagttattagtagggataagtagaaatatcagtagaattaagtttagtagaaagtcta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17602851 |
tggagagtatggttgatgttaaattttggtgaagaccttaaatagttattagta-ggataagtagaaatatcagtagaattaagtttagtagaaagtcta |
17602753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 198 - 234
Target Start/End: Complemental strand, 17602616 - 17602580
Alignment:
| Q |
198 |
agaaagtctaagattataagttgttttgatagaattt |
234 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
17602616 |
agaaagtccaagattataagttgttttgatagaattt |
17602580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University