View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14555_low_10 (Length: 227)
Name: NF14555_low_10
Description: NF14555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14555_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 4963518 - 4963731
Alignment:
| Q |
1 |
ttcatcagtaaggacaactcaaggtagatattttcatgcgctttaaattaaatcgttaaaaacatttacaaactcaattttcttagccaaaggcaaaact |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4963518 |
ttcatcagccaggacaactcaaggtagatattttcatgcgctttaaattaaatcgttaaaaacattttcaaactcaattttcttagccaaaggcaaaact |
4963617 |
T |
 |
| Q |
101 |
ttaa----cgacttaaaaaatctcattgtaaaaatgatcaagttaagattaccgggcagtcgggatgatgtctgggtatattttgatagaagtgttgtga |
196 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4963618 |
ttaattaacgacttaaaaaatcccattgtaaaaatgatcaagttaagattaccgggcagtcgggatgatgtctgggtatattttgatagaagtgttgtga |
4963717 |
T |
 |
| Q |
197 |
aggtatccaggctc |
210 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4963718 |
aggtatccaggctc |
4963731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University