View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14557_high_13 (Length: 271)
Name: NF14557_high_13
Description: NF14557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14557_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 34 - 251
Target Start/End: Original strand, 4834294 - 4834512
Alignment:
| Q |
34 |
cgtactcttcaccttataaatatggaaaacattaccccctaagtgttgtatttgtgtctagattgtgcgtgcaaatagcaattt-caagcaaatttaagt |
132 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4834294 |
cgtactcttcaccttataaatatggagaacactaccccctaagtgttgtatttgtgtctagattgtgcgtgcaaatagcaattttcaagcaaatttaagt |
4834393 |
T |
|
| Q |
133 |
ttggaaggtgtgataaccaaaatggacaaattttcctgagtgaagttttgatccttaatattgtggaggaatgaggatcgttatcaaatgcagccaatgt |
232 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4834394 |
ttggaaggtttgataaccaaaatggacaaattttcctgagtgaagttttgatccttaatattgtggaggaatgaggatcgttatcaaatgcagccaatgt |
4834493 |
T |
|
| Q |
233 |
cgcctcaatcgtgactgcc |
251 |
Q |
| |
|
||||| ||||||||||||| |
|
|
| T |
4834494 |
cgccttaatcgtgactgcc |
4834512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University