View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14557_high_18 (Length: 238)
Name: NF14557_high_18
Description: NF14557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14557_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 23 - 216
Target Start/End: Original strand, 19077862 - 19078055
Alignment:
| Q |
23 |
agaacatcctgctcaaatcccatggtaaccattccctttggtacctcaacaaaggaataatcaaattcgatgatgcgttagttatctcaatcatcatttc |
122 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19077862 |
agaacatcctgctcaaatcccacggtaaccattccctttggtacctcaacaaaggaataatcaaattcgatgatgcgttagttatctcaatcatcatttc |
19077961 |
T |
 |
| Q |
123 |
actttgatcaaaattaacgtcttctaacaaattcagatcagtccacctctcgtgtttatctctccaaggatgccataacaatattgtcttagtg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
19077962 |
actttgatcaaaattaacgtcttctaacaaattcagatcaatccacctctcatgtttatctctccaaggatgccataacaatactatcttagtg |
19078055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 85
Target Start/End: Complemental strand, 17408896 - 17408846
Alignment:
| Q |
35 |
tcaaatcccatggtaaccattccctttggtacctcaacaaaggaataatca |
85 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||| ||| |||| ||||| |
|
|
| T |
17408896 |
tcaaagcccatgctaaccattccctttggtacctcagcaacggaacaatca |
17408846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University