View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14557_high_23 (Length: 207)
Name: NF14557_high_23
Description: NF14557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14557_high_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 54086195 - 54086267
Alignment:
| Q |
1 |
gtttttgtttcttttgtttgcgttcatcttcatcatcgttgttgttggaatatggatcgttgattaaattggg |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54086195 |
gtttttgtttcttttgtttgcgttcatcttcatcatcgttgttgttggaatatggatcgttgattaaattggg |
54086267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 110 - 149
Target Start/End: Original strand, 54086304 - 54086343
Alignment:
| Q |
110 |
aagatccaacagagatggacgacccttcttcttcctcttt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54086304 |
aagatccaacagagatggacgacccttcttcttcctcttt |
54086343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University