View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14557_low_12 (Length: 284)
Name: NF14557_low_12
Description: NF14557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14557_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 85 - 277
Target Start/End: Complemental strand, 1951246 - 1951054
Alignment:
| Q |
85 |
acacataaattgaagaaaacattcataaaatattttagggaaaatgaaatagttcatcgttgaatgagatgcatctgaagcattgtagttattggaagtt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1951246 |
acacataaattgaagaaaacattcataaaatattttagggaaaatgaaatagttcatcgttgaatgagatgcatctgaagcattgtagttattggaagtt |
1951147 |
T |
 |
| Q |
185 |
ggttctagtcagagctatccgtatgttgagtttgtattcaagctcaaggttcttttgaccgtttgtcaaagactacgtgcatcatattcttcg |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1951146 |
ggttctagtcagagctatccgtatgttgagtttgtattcaagctcaaggttcttttgaccgtttgtcaaagactacgtgcatcatattcttcg |
1951054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University