View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14557_low_13 (Length: 277)
Name: NF14557_low_13
Description: NF14557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14557_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 9 - 56
Target Start/End: Original strand, 6466014 - 6466061
Alignment:
| Q |
9 |
aaaagtctagaattatgaaccttacaatcaaaaagggtccataatcaa |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6466014 |
aaaagtctagaattatgaaccttacaatcaaaaagggtccataatcaa |
6466061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 228 - 277
Target Start/End: Original strand, 6466181 - 6466230
Alignment:
| Q |
228 |
ctgctatactgctccacactgttatccagcaaatctccactgtcttttca |
277 |
Q |
| |
|
||||| || |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6466181 |
ctgctgtattgctccacactgttatccagcaaacctccactgtcttttca |
6466230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University