View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14557_low_13 (Length: 277)

Name: NF14557_low_13
Description: NF14557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14557_low_13
NF14557_low_13
[»] chr1 (2 HSPs)
chr1 (9-56)||(6466014-6466061)
chr1 (228-277)||(6466181-6466230)


Alignment Details
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 9 - 56
Target Start/End: Original strand, 6466014 - 6466061
Alignment:
9 aaaagtctagaattatgaaccttacaatcaaaaagggtccataatcaa 56  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
6466014 aaaagtctagaattatgaaccttacaatcaaaaagggtccataatcaa 6466061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 228 - 277
Target Start/End: Original strand, 6466181 - 6466230
Alignment:
228 ctgctatactgctccacactgttatccagcaaatctccactgtcttttca 277  Q
    ||||| || |||||||||||||||||||||||| ||||||||||||||||    
6466181 ctgctgtattgctccacactgttatccagcaaacctccactgtcttttca 6466230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University