View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14557_low_15 (Length: 264)
Name: NF14557_low_15
Description: NF14557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14557_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 12 - 246
Target Start/End: Complemental strand, 47036377 - 47036143
Alignment:
| Q |
12 |
tagcaaaggacatgtcccaaatagtttgagtaatatgaaagtagaagacttaatagatagtaatgagcaatggaatttatctctattaaataaatagcca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47036377 |
tagcaaaggacatgtcccaaatagtttgagtaatatgaaagtagaagacttaatagatagtaatgagcaatggaatttatctctattaaataaatagcca |
47036278 |
T |
 |
| Q |
112 |
cttgttagatgatatagtccttgacataaggagcctagtgcaatctgatatcaatttaagagctgatttgtgtgttaccctgggatattgtcgctaccac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47036277 |
cttgttagatgatatagtccttgacataaggagcctagtgcaatctgatatcaatttaggagctgatttgtgtgttaccctgggatattgtcgctaccac |
47036178 |
T |
 |
| Q |
212 |
ttacaagttacaagtccctttgcaggtttaataac |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
47036177 |
ttacaagttacaagtccctttgcaggtttaataac |
47036143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University