View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14557_low_20 (Length: 238)
Name: NF14557_low_20
Description: NF14557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14557_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 2036374 - 2036155
Alignment:
| Q |
1 |
tctcattattatatcacttttctatgttagttcgtaaaatatcttgaaattattacacaatgagttgtgattggatgcatgtgnnnnnnnnngttttcat |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
2036374 |
tctcatcattatatcacttttctatgttagttcgtaaaatatctcgaaattattacacaatgagttgtgattgaatgcatgtgaaaaaaaa-gttttcat |
2036276 |
T |
 |
| Q |
101 |
tgatagtgcatacctatttctcatttcacattcaagtgcatagtatatgtataatgtagtaactactaagtaatacattgctcacacaatcatgttttat |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2036275 |
tgatagtgaatacctatttctcatttcacattcaagtgcatagtatatgtataatgtagtacctactaagtaatacattgctcacacaatcatgttttat |
2036176 |
T |
 |
| Q |
201 |
atcaatagtaattactaattg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2036175 |
atcaatagtaattactaattg |
2036155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University