View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14558_low_6 (Length: 234)
Name: NF14558_low_6
Description: NF14558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14558_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 103 - 216
Target Start/End: Original strand, 551450 - 551563
Alignment:
| Q |
103 |
gtacataaattataagtaggacacgtgttattgtgaagtaaaactaacatatttaaaaggtaaagatatatgcaagggtaatattgaattggagcaaaaa |
202 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
551450 |
gtacgtaaattataagtaggacacgtgttattgtgaagtaaaactaacatattcaaaaggtaaagatttatgcaagggtaatattgaattggagcaaaaa |
551549 |
T |
|
| Q |
203 |
taggctacactaga |
216 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
551550 |
taggctacactaga |
551563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 9 - 80
Target Start/End: Original strand, 551365 - 551434
Alignment:
| Q |
9 |
gagtgaaaagaactattgccaatgaaagatgatattttat-catactagcgtgcatgcatgcattatgcctct |
80 |
Q |
| |
|
|||||| || |||||||||||||||||||| ||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
551365 |
gagtgataaaaactattgccaatgaaagat---attttattcatactagcgtgcatgcatgctatatgcctct |
551434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University