View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1455_high_17 (Length: 242)

Name: NF1455_high_17
Description: NF1455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1455_high_17
NF1455_high_17
[»] chr2 (1 HSPs)
chr2 (23-230)||(9711135-9711340)


Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 23 - 230
Target Start/End: Original strand, 9711135 - 9711340
Alignment:
23 tctgaaatatagacatagttttaggcttatgcttaaccttttttagtgttgttgttctcatatccatagttttttaaaaatgcatgaaaatgagcnnnnn 122  Q
    ||||||||||| || ||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| ||| |||  |||||||||||||         
9711135 tctgaaatatatac-tagttttaggcttatgcctaacctttttgagtgttgttgttctcatatccatagtttcttagaaacacatgaaaatgagcaaaaa 9711233  T
123 nnnctcagcggtaattatattttgctatatgtcagtctaacccttttaaaatccgaatacaactttatttttggactaggtctaacgagtagcttatagt 222  Q
       |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
9711234 at-ctcaacggtagttatattttgctatatgtcagtctaacccttttaaaatccgaatacaactttatttttggactaggtctaacgagtagtttatagt 9711332  T
223 gaatagtg 230  Q
    | ||||||    
9711333 ggatagtg 9711340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University