View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1455_high_17 (Length: 242)
Name: NF1455_high_17
Description: NF1455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1455_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 23 - 230
Target Start/End: Original strand, 9711135 - 9711340
Alignment:
| Q |
23 |
tctgaaatatagacatagttttaggcttatgcttaaccttttttagtgttgttgttctcatatccatagttttttaaaaatgcatgaaaatgagcnnnnn |
122 |
Q |
| |
|
||||||||||| || ||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| ||| ||| ||||||||||||| |
|
|
| T |
9711135 |
tctgaaatatatac-tagttttaggcttatgcctaacctttttgagtgttgttgttctcatatccatagtttcttagaaacacatgaaaatgagcaaaaa |
9711233 |
T |
 |
| Q |
123 |
nnnctcagcggtaattatattttgctatatgtcagtctaacccttttaaaatccgaatacaactttatttttggactaggtctaacgagtagcttatagt |
222 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9711234 |
at-ctcaacggtagttatattttgctatatgtcagtctaacccttttaaaatccgaatacaactttatttttggactaggtctaacgagtagtttatagt |
9711332 |
T |
 |
| Q |
223 |
gaatagtg |
230 |
Q |
| |
|
| |||||| |
|
|
| T |
9711333 |
ggatagtg |
9711340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University