View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1455_high_20 (Length: 237)
Name: NF1455_high_20
Description: NF1455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1455_high_20 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 9 - 237
Target Start/End: Original strand, 49520161 - 49520389
Alignment:
| Q |
9 |
catcatcacagtataatttccaattcctctcagcaacgcggttcaaaagttttacacattccagcctttcaggctcgtcaaaatcatcgctgttatctcc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49520161 |
catcatcacagtataatttccaattcctctcagcaacgcggttcaaaagttttacacattccagcctttcaggctcgtcaaaatcatcgctgttatctcc |
49520260 |
T |
|
| Q |
109 |
aatgtgttcataccataatgctctcctgaagccatacacctgaccttgtggtctttgtgagccattggatgtggatgctagatgatgaggttgaaatgca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49520261 |
aatgtgttcataccataatgctctcctgaagccatatacctgaccttgtggtctttgtgagccattggatgtggatgctagatgatgaggttgaaatgca |
49520360 |
T |
|
| Q |
209 |
cccattgcaatctctgtgtctcttccacc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
49520361 |
cccattgcaatctctgtgtctcttccacc |
49520389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University