View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1455_high_25 (Length: 206)
Name: NF1455_high_25
Description: NF1455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1455_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 68 - 189
Target Start/End: Complemental strand, 31931479 - 31931358
Alignment:
| Q |
68 |
tgtcagctttattcatatatagttgaattattgagaaaatgaggacctaaaaggtacatttttcctgcacattttcaccccccacatttcttatatcact |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31931479 |
tgtcagctttattcatatatagttgaattattgagaaaatgaggacctaaaaggtacatttttcctgcacattttcaccccccacatttcttatatcact |
31931380 |
T |
 |
| Q |
168 |
atcataggtctagaagtggtgg |
189 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31931379 |
atcataggtctagaagtggtgg |
31931358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 31931546 - 31931503
Alignment:
| Q |
1 |
cacatggtcgaacagattcttgtgtcaaaatcaaataaactcat |
44 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31931546 |
cacatggtcgatcagattcttgtgtcaaaatcaaataaactcat |
31931503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University