View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1455_low_10 (Length: 296)
Name: NF1455_low_10
Description: NF1455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1455_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 289
Target Start/End: Complemental strand, 8003469 - 8003199
Alignment:
| Q |
19 |
tctggtatgtatctctatgaagggaacacattgcttgatttttccttgctcttaatacaaatgtggaatcctataacattaagaatggtaacctaagtat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8003469 |
tctggtatgtatctctatgaagggaacacattgcttgatttttccttactcttaatacaaacgtggaatcctataacattaagaatggtaacctaagtat |
8003370 |
T |
|
| Q |
119 |
gcggggaactttgttactggaagactaggcatggttatgagcatcacggcggctaacggaacttgtggctgacaattatctttcactggaaacggcagtt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8003369 |
gcggggaactttgttactggaagactaggcatggttatgagcatcacggcggctaacggaacttgtggctgacaattatctttcactggaaacggcagtt |
8003270 |
T |
|
| Q |
219 |
ggtgagagagttgaggatgccaatagtagttcgtgttggaaggaatgaaggtggaaattcaacctttgcta |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8003269 |
ggtgagagagttgaggatgccaatagtagttcgtgttggaaggaatgaaggtggaagttcaacctttgcta |
8003199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 252 - 289
Target Start/End: Original strand, 30517851 - 30517888
Alignment:
| Q |
252 |
tgttggaaggaatgaaggtggaaattcaacctttgcta |
289 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
30517851 |
tgtttgaaggaatgaaggtggaagttcaacctttgcta |
30517888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University